På dna-dagen: Genetik utan dna

Så här på dna-dagen tänkte jag skriva lite om vad som går att göra utan att veta något om dna, och varför det (förstås) blir ännu bättre med dna.

Vi tänker oss tillbaka till tiden före genomprojekt, sekvenseringsmaskiner och kloning. Säg någon gång i 1900-talets början. Vad vet vi om ärftlighet? Vi vet att egenskaper går i arv. Det behöver man inte vara något ljushuvud för att lägga märke till. Vi vet att djuravel och växtförädling fungerar. Det vill säga, om man väljer ut de individer som har egenskaper vi behöver och låter dem para sig, så kommer nästa generation bli ännu bättre. Det är 1700-talskunskap allra minst, och förmodligen mycket äldre än så. Vi har en teori om ärftlighet, från Mendel och hans berömda ärtor  Vi vet att ärftligheten består av anlag som blandas om varje generation, men utan att spädas ut. Det är de som idag kallas genetiska varianter.

Varje individ har en uppsättning genetiska varianter. De påverkar individens egenskaper, och de går vidare till nästa generation när individen får barn. Modernt uttryckt: Alla individer har gener, och de finns i olika genetiska varianter. Alla har två varianter av varje gen, och en av dem kommer gå vidare till varje avkomma. Vi vet ännu inte vad generna består av (spoiler: det är dna).

En del egenskaper är enkla, och verkar styras av varianter av en enda gen. En höna kan ha vita fjädrar eller färgade, till exempel; det styrs av varianter av en enda gen. Den ena varianten gör hönan vita fjädrar, och den andra tillåter andra färger att komma fram. Egenskapen delar in höns i två typer: vita höns och höns med andra färger.

Men de flesta egenskaper är inte så enkla. Ta hur mycket hönan väger. Höns kommer i alla storlekar, små, stora och mittemellan. Det är ofta sådana egenskaper som är viktigast. Hur stor blir hönan? Hur många ägg lägger hon? Hur rädd är hon för människor? Och så vidare. Hur gör vi om vi vill förstå en sådan kvantitativ egenskap?

Vi utgår ifrån det faktum att det finns många gener som påverkar en kvantitativ egenskap. Varje gen finns i flera varianter, och varje individ har två varianter. Vi börjar med att anta något helt orealistiskt, nämligen att vi vet exakt vilka genetiska varianter som finns, och vilka effekter de har. Då kan vi skriva ner en individs egenskap som en summa, där varje term beror på de genetiska varianter individen bär på, plus ett slumpvis bidrag från olika miljöfaktorer. Därifrån kan vi dra slutsatser om medelvärden och variation inom en population av individer och, viktigast av allt, formler för hur nära släktingar liknar varandra.

Då trillar det ut något användbart. De här orealistiska sakerna vi antog i början, att vi kände till varje genetisk variant och vad den gör, visar det sig att vi inte behöver veta. De försvinner ur formlerna. Det är som om vi hade en ekvation med X på båda sidor om likhetstecknet. Då kan vi dividera med X, så den okända variabeln försvinner. Med bara ett släktträd och mätningar av individernas egenskaper går det att räkna fram en massa användbara genetiska värden, utan att behöva veta exakt vilken gen som gör vad. Till exempel kan vi ta reda på vilka individer vi helst borde avla på, eller hur stor del genetiska varianter spelar för en viss egenskap.

Teorin om kvantitativa egenskaper utvecklades i början av 1900-talet. Det är en statistisk teori, som beskriver hur ärftliga egenskaper förs vidare i släktträd och populationer. Den är väl medveten om att det finns gener och genetiska varianter, men klarar sig bra utan att hantera dem direkt.

Ungefär vid samma tid började helt andra forskare reda ut vad arvsanlagen består av. 1953 visste vi inte bara att är dna som är boven i dramat, utan också hur dna-molekylen ser ut. Sedan kom molekylärgenetik, det vill säga genetik som arbetar direkt med dna.

På senare år har kvantitativ genetik och molekylärgenetik mötts på flera sätt. Det har blivit så lätt och billigt (relativt sätt) att göra dna-tester, att många börjat använda dem istället för släktträd. Istället för att mödosamt hålla reda på individers släktskap kan vi titta på deras genetiska varianter direkt, och uppskatta släktträdet från dna.

Det har också blivit möjligt att ta reda på vilka genetiska varianter som påverkar egenskaper, hur mycket de påverkar, och hur de fungerar. Då kan vi får reda på saker som inte syns i släktträd: hur många genetiska varianter som spelar roll för en egenskap, om varianterna är vanliga eller ovanliga, hur stora eller små deras effekter är, och hur de åstadkommer dem. Hur kan små skillnader i dna göra en höna större eller mindre, mer eller mindre rädd för människor, eller få henne att lägga fler eller färre ägg? Men det får vi prata mer om en annan dag.

(Idag var det tydligen dna-dagen, även om den snart är slut. Gamla dna-dagsposter: Gener, orsak och verkan (2015), På dna-dagen (2014))

På dna-dagen: Gener, orsak och verkan

”DNA, livets molekyl” … Visst, DNA är en viktig och snygg biomolekyl. Men varför skulle inte en komplex kolhydrat, ett protein eller en membranlipid förtjäna det namnet?

Det finns två perspektiv på genetik som jag brukar tjata om. Å ena sidan: genetik som handlar om vad molekylära gener gör och vad de har för funktion. Å andra sidan: genetik som är studiet av ärftliga skillnader mellan individer, och i förlängningen populationer och arter. Genetik beskrivs ibland som en vetenskap som handlar om ”koder” och ”information”. Det ligger något i det, men jag tror det är bra att vara lite försiktig med metaforerna. Jag misstänker att koder och information inte är något vi bara hittar liggande ute i naturen, så att säga, utan mänskliga tolkningar.

Ja, vissa DNA-sekvenser skrivs av till mRNA som kodar för proteiner. Här betyder ”kodar för” att sekvensen har tripletter av baser som är komplementära mot tRNA-molekyler som bär aminosyror. Andra sekvenser motsvarar RNA-molekyler som har någon annan funktion. Men de orsakande faktorerna till att ett visst RNA uttrycks vid en viss tid finns inte i DNA, utan någon annan stans. DNA är en del av mekanismen, men det är också RNA-polymeraset som skriver av det, spliceosomen som sätter ihop aktivt mRNA, de system av enzymer som tillverkar nukleotiderna och så vidare, och så vidare. Processen aktiveras av vad som händer i organismens miljö, interna processer som omfattar många delar av cellen eller helt olika delar av kroppen osv. På så sätt är kärnan med sitt DNA en organell vilken som helst.

Men! Det finns ett sammanhang där det är befogat att prata om genetiska orsaker, nämligen ärftliga skillnader mellan individer. Det går att hitta (och faktiskt konstruera) exempel på individer där dramatiska skillnader i egenskaper som utseende och beteende beror på en skillnad i DNA-sekvens — en genetisk variant eller ”gen” i den klassiska bemärkelsen. Det förstås, det kan finnas andra typer av ärftlighet som inte beror på DNA, och i så fall borde de också räknas med här. Men de flesta saker som inuti celler kan göra skillnad i en organisms egenskaper — proteiner, membranlipider, kolhydrater, små organiska molekyler osv — nollställs mellan generationerna, när könsceller bildas och utvecklingen så att säga börjar om varje generation. Men DNA går i arv — med sin ”information”, om en så vill.

(Den 25 april 1953 publicerades artiklarna som presenterade DNA-molekylens struktur. Därav DNA-dagen. Min DNA-dagspost från förra året: På dna-dagen)

På dna-dagen

Idag är det tydligen dna-dagen enligt någon; det är i alla fall roligare än kanelbullens dag. Den 25 april 1953 var dagen då artiklarna (Watson & Crick 1953; Franklin & Gosling 1953; Wilkins, Stokes & Wilson 1953) om dna-molekylens struktur publicerades, och dagen då en typ 150-årig jakt på arvsanlagens molekylära natur på något sätt kulminerade. Från äckligt var från något sår till dna-sekvenser, typ. Alla har sett någon bild på dna-strängen, så jag väljer medvetet att inte visa någon sådan. Istället tänkte jag skriva några rader om dna som kod, en vanlig metafor som både är bra och dålig.

Deoxyribonukleinsyra (dna) är en uppbyggt av en ryggrad av deoxyribos samt olika kombinationer av fyra kvävebaser (adenosin, tymin, guanidin och cytosin; de förkortas med sin begynnelsebokstav som A, T, G och C). De kan kombineras i olika ordning och det är följden av A, T, G och C som bildar den dna-sekvens som lagrar biologisk information. En normal dna-molekyl består av två strängar som löper i motsatt riktning. Baserna bildar par där G kombineras med C och A med T. Båda strängarna lagrar alltså samma information men i motsatt och, som det kallas, komplementär riktning.

Sedan bildar dna-molekyler kromosomer: en kromosom är en lång dna-molekyl upplindad på proteiner. Vi diploida organismer har två uppsättningar av våra kromosomer: en från mamma och en från pappa. Genomet är den sammanlagda sekvensen från en uppsättning av alla kromosomer. När en pratar om det mänskliga genomet menar en den mänskliga referenssekvensen, som är ett exempel på hur en uppsättning kromosomer kan se ut. Det finns naturligtvis genetisk variation mellan indiver. Ta till exempel följande bit från människans kromosom 1:

>1 dna:chromosome chromosome:GRCh37:1:11013:12345:1
GGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGCACGGCGCCGGGCTGGGGCGGGG
GGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGGCGCAGAGACGGG
TAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCACTA
CAGGACCCGCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACT
GCAGGGCTCTCTTGCTTAGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAG
GGCCCTCTTGCTTACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCA
GGGTCCTCTTGCTCAAGGTGTAGTGGCAGCACGCCCACCTGCTGGCAGCTGGGGACACTG
CCGGGCCCTCTTGCTCCAACAGTACTGGCGGATTATAGGGAAACACCCGGAGCATATGCT
GTTTGGTCTCAGTAGACTCCTAAATATGGGATTCCTGGGTTTAAAAGTAAAAAATAAATA
TGTTTAATTTGTGAACTGATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAATG
TCTAGGAATGCCTGTTTCTCCACAAAGTGTTTACTTTTGGATTTTTGCCAGTCTAACAGG
TGAAGCCCTGGAGATTCTTATTAGTGATTTGGGCTGGGGCCTGGCCATGTGTATTTTTTT
AAATTTCCACTGATGATTTTGCTGCATGGCCGGTGTTGAGAATGACTGCGCAAATTTGCC
GGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCAGCACCGGGTATCATT
CACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTC
ATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGA
GGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCT
GGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCAT
GCCTAGAGTGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAA
TACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGAGAGCATCAACTTCTC
TCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACGTGGCCG
GCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCG
GGCTGTGACTGCT

Men om jag intresserade mig för den här sekvensen skulle jag antagligen betrakta den på en ännu högre abstraktionsnivå, ungefär såhär. Detta är en bild från genomläsaren Ensembl. Detaljerna är inte så viktiga; poängen med den här illustrationen är att genetiken till stor del abstraherar bort den underliggande biokemin. Vi betraktar inte dna-sekvensen direkt, utan med olika bekvämare representationer av dna-sekvensen.

ensembl_human_chr1

Ibland pratar en om den genetiska koden. Med det uttrycket avses inte hela genomet, utan de ungefär 2% som specificerar sekvensen för proteiner. Det är nämligen så att vissa dna-sekvenser, proteinkodande gener, följer en viss kod som motsvarar en sekvens av aminosyror. Aminosyror, i sin tur, bygger upp proteiner, som är biologiskt aktiva stora organiska molekyler som gör saker i celler och kroppar. Proteiner kan vara enzymer som katalyserar olika reaktioner, transportproteiner som flyttar molekyler fram och tillbaka, strukturella proteiner som bygger upp vävnader etc etc. Den genetiska koden, som det kallas, betsår av tripletter av baser, där en tre baser motsvarar en aminosyra. ATG till exempel, motsvara aminosyran metionin samt även startsignalen för att bygga ett protein. TTT motsvarar fenylalanin, GTA valin och så vidare. TAA, TAG eller TGA innebär att den kodande genen är slut och att proteinsekvensen är färdig.

Men det finns andra dna-sekvenser som har andra funktioner än att koda för proteiner. De är svårare att beskriva och hantera, för deras kod är inte lika regelbunden och lätthanterlig som den genetiska koden, men de är ändå viktiga. Till exempel finns det dna-sekvenser som reglerar när och hur mycket olika delar av kroppen kommer använda proteinkodande gener till att faktiskt tillverka proteiner.

Majoriteten av genomet består inte av gener, utan av diverse jox som inte fyller någon direkt funktion. Spaghettikod är ett skällsord som programmerare ibland använder för kod som är svår att överblicka, förvirrande, och som när den körs kommer hoppa hit och dit. Om det mänskliga genomet ska beskrivas som kod är det förmodligen någon sorts spaghettikod. Jag tänkte länge att ett datorprogram är en fruktansvärt dålig metafor för ett genom, eftersom programkod är konstruerad av mänskliga medvetanden som har en plan. Men mina vänner som arbetar med programmering har övertygat mig om att ett tillräckligt stort mjukvaruprojekt med många inblandade ibland utvecklas lite som ett genom, med en kombination av slumpvisa händelser och naturligt urval, inte bara som en process av rationell design.

Att ta fram DNA och RNA (Så går det till, del 5)

Hittils har den här serien handlat om olika saker vi kan göra med nukleinsyror i labbet, och allihop har förutsatt att vi har en hyfsat ren lösning DNA eller RNA. Hur får vi en sådan?

Det finns massor av olika recept för att isolera DNA och RNA. Demonstrationen ovan är nog den enklaste tänkbara, men den ger knappast särskilt rent DNA. Jag tänkte att vi kunde titta på de två kanske viktigaste principerna. Varje tillverkare med självaktning har en egen variant som heter något snarlikt.

Alla metoder går i stora drag ut på att bryta sönder provet och på något sätt rena fram DNA och RNA från proteiner, fetter, kolhydrater och så vidare som finns i provet. I videon ovan är de två stegen 1) mosa jordgubbarna i en påse med diskmedel och 2) fälla DNA med alkohol och salt.

Det som varierar mest mellan olika prover är det första steget: på något sätt måste vi ta sönder provet för att cellerna ska öppnas och nukleinsyran komma ut. Hur mycket våld som krävs beror på vilken sorts prov det är frågan om — bakterieceller som växer i en näringslösning brukar är lättare att ta sönder en stammen från en växt eller kanske en bit ben.

Allt bygger på att nukleinsyrorna har andra kemiska egenskaper än proteiner och fetter. Båda metoderna fungerar för DNA eller RNA med lite olika justeringar. Men helt går det inte alltid att skilja DNA från RNA och för att vara på den säkra sidan finns det specifika DNA- eller RNA-nedbrytande enzymer som går att använda.

DNA och RNA är rätt lika molekyler, men DNA tål betydligt mer. Problemet med RNA är dels att det bryts sönder om vattenlösningen det ligger i värms upp. Dessutom är omgivningen full av RNAser, RNA-nedbrytande enzymer. De finns överallt (alla celler behöver kunna bryta ner RNA) och de är inte lätta att inaktivera. Därför är damm, fingrar och värme de främsta hoten mot våra dyrbara RNA-prover. Därför kan vi som jobbar med RNA ibland vara lite stirriga.

Fenol-kloroformextraktion

Extraktion är en gammal hederlig kemisk teknik. Det bygger på att polära och opolära vätskor — som olja och vatten — inte löser sig i varandra utan bildar två lager. I korthet går fenol-kloroformextraktionen till såhär: vi tar vårt sönderslagna prov som innehåller lite allt möjligt jox — proteiner, fett, kolhydrater, salter och så vidare — och blandar den med fenol och guanidintiocyanat. Guanidintiocyanat är ett salt som inaktiverar de flesta protiner och skyddar därför RNA från att bli nedbrutet av RNaser. Så häller vi på ett organiskt lösningsmedel som kloroform (vilket får en att känna sig som en gammal filmskurk).

Nu börjar själva extraktionen! Vi skakar som sjutton och väntar på att faserna ska separera igen. Det är som olja och vatten, men här är den organiska fasen tyngre än vattnet och lägger sig alltså under vattenfasen. Snart bildas två lager: det undre (som i vissa tillverkares version är rosafärgat — hurra!) är den organiska fasen och innehåller DNA och proteiner; det övre genomskinliga är en vattenlösning och där finns RNA. Det är bara att suga upp den övre fasen med en pipett och gå vidare med den.

Sedan fäller vi fram det från vattenlösningen. Det är samma sak som i videon ovan, men resultatet blir mycket renare, eftersom vi gjort en  extraktion först. Med hjälp av en alkohol och lite salt får vi nukleinsyran att falla ut och bilda en vit pellet i botten. Nukleinsyran är inte särskilt löslig i alkohol, så vi kan tvätta pelleten med etanol en eller ett par gånger. När den är tillräckligt ren suger vi bort etanolen, låter pelleten torka och löser upp den i vatten. Voilá — en hyfsat ren RNA-lösning!

Fenol-kloroform är en klassisk metod; den kan också användas till DNA-isolering och till att rena DNA efter olika enzymbehandlingar — men det tar tid och kemikalierna är duktigt giftiga.

Spinnkolonnmetoder

En kolonn är, i allmänhet, ett rör proppat med något material som används för att göra någon sort kemisk separation. En spinnkolonn är en liten kolonn som passar i en centrifug så att det går att snurra den och få vätska att passera genom den snabbare. Spinnkolonner för DNA- och RNA-isolering innehåller kisel, där nukleinsyran fastnar.

I korthet går det till såhär: vi blandar vårt prov med en lösning med ett guanidinsalt (åter igen) och häller i kolonnens ena ände. Nukleinsyran fastnar i kolonnen, men det andra går rakt igenom. Vi sköljer igenom kolonnen några gånger med etanolbaserad tvättlösning för att få bort så mycket skräp som möjligt. Sedan, när vi vill att nukleinsyran ska släppa, sätter vi till en vattenlösning eller i vissa kolonner bara rent vatten. Det som kommer ut fångar vi upp i ett rör. Klart!

Den här beskrivningen är mycket kortare än den ovanstående, och i allmänhet går det nog också fortare än fenol-kloroformmetoden. Vad som funkar bäst? Det beror förmodligen på provet och vad vi vill få ut av det. Väldigt korta RNA-strängar fastnar inte så bra i en spinnkolonn. Vissa prover kan bli renare i den ena metoden eller den andra — ibland krävs både och: först fenol-kloroform och sedan en spinnkolonn. Ibland kan det duga med någon enklare isoleringsmetod som mer liknar det som händer med  jordgubbarna i videon.

Med det tror jag vi behandlat allt som krävs för PCR-baserad DNA- och RNA-analys. Så, kära läsare, vad ska vi ta upp härnäst?