agcgaaaaagtggaaaacagcgaacgcattaacggc (Så går det till, del 4)

Nu är det ungefär åtta år sedan det mänskliga genomprojektet avslutades. Nu pratas det med jämna mellanrum om den sköna nya värld när alla kommer kunna sekvensera sitt genom. (Vad i hela friden vi ska med våra individuella genomsekvenser till är fortfarande en öppen fråga. Jag föreslår att skriva ut den på ett ungefär trehundra mil långt toalettpapper att släpa runt på.) Samtidigt strömmar det in nya organismer, senast tror jag kakao och jordgubbe, som fått en referenssekvens. Tidningar brukar oftast kalla det ”kartläggning” eller att ”knäcka den genetiska koden”, men de menar nästan alltid sekvensering.

Att ta fram en referenssekvens är fortfarande ett hårt jobb, men det är när den är klar som den verkliga sekvenseringen kan börja. Då blir det lätt för de som är intresserade av någon viss gen eller viss kandidatregion att sekvensera den och hitta intressanta genetiska variationer. Och den moderna sekvenseringen, som snabbt läser av DNA från många slumpvis valda delar av genomet och sedan lappar ihop det till en hyfsat heltäckande sekvens, behöver en bra referenssekvens.

Sådana massivt parallella sekvenseringsmetoder (med namn som Illumina Genome Analyzer, SOLiD och Roche 454) kommer starkt för tillfället. Men Sangersekvensering är förmodligen fortfarande den viktigaste metoden, vid sidan av alternativet pyrosekvensering. (Det finns andra tidigare metoder och den numera typ övergivna Maxam-Gilbertsekvenseringen, men de är drygare.) Alltså — Sangers enzymatiska sekvensering med avbrutna kedjor!

Vi börjar med en primer — precis som i PCR, fast det behövs bara en — en kort DNA-sekvens som passar där vi vill börja läsa. Så kommer DNA-polymeraset, utgår från primern och bygger upp en ny sträng som kopierar den gamla. Den nya strängen byggs upp av nukleotider — en av baserna A, T, G, C som sitter ihop med en sockermolekyl. Så långt allt gott. Det är bara det att vi satt till en andel stoppnukleotider — nukleotider som är kemiskt lite annorlunda och inte går att bygga vidare på.

När polymeraset råkar sätta in en stoppnukleotid är den strängen slut. Stoppnukleotiden är dessutom märkt med en fluorescent molekyl i en av fyra färger, en för varje bas. Resultatet är en blandning av strängar av olika längd som fluorescerar (avger ljus när den blir belyst) i olika färg beroende på vilken bas de slutar med.

Så, om vi bara kan sortera DNA-fragmenten i storleksordning kan vi läsa av sekvensen som en serie av fluorescenta ljus. Hur storlekssorterar vi? Med gelektrofores! Sekvenseringmaskiner brukar använda ett tunnt glasrör med gel och ha en fast detektor som DNA-bitarna passerar igenom. När de åker förbi lyser detektorn på dem med laser och ser vilken färg som lyser tillbaka.

Sedan ritar den ett diagram med en kurva för varje färg, där sekvensen framträder som en bergskedja av toppar i olika färger. (Eller snarare, det gör ett datorprogram på datorn kopplad till maskinen — om någon vet om ett trevligt fritt program för Sangersekvensering, berätta för mig!)

Den här metodens nackdel är att den bara kan sekvensera en ganska kort sekvens i taget, upp till kanske tusen baspar. Början av sekvensen brukar också vara svår att läsa av. För att konstruera en referenssekvens behövs det alltså ohyggliga mängder sekvenseringsreaktioner; det mänskliga genomet är ungefär tre miljarder baser. Å andra sidan går det fort att köra en reaktion, och numera är bara att stoppa sitt prov (till exempel en renad PCR-produkt) i ett kuvert och skicka till något av alla de företag som gör sekvensering för typ 100 kr per reaktion.

(Rubriken är ett exempel på den genetiska koden. Proteiner byggs upp av aminosyror, som motsvarar en trio av baspar i en gen. Trion kallas kodon — och vilka kodoner som motsvarar vilken aminosyra kallas den genetiska koden. ”GCT” står för aminosyran alanin, till exempel. I en annan, inte genetisk utan mänsklig, kod förkortas varje aminosyra med en bokstav ur alfabetet. Rubriksekvensen skapades med webbprogrammet Reverse Translate — nej, jag kan det inte i huvudet. Den kan översättas tillbaka till exempel med Transeq.)

One thought on “agcgaaaaagtggaaaacagcgaacgcattaacggc (Så går det till, del 4)

  1. Pingback: Hönsgenetik: Blå äggskal och gamla virusbitar « There is grandeur in this view of life

Kommentera

Fyll i dina uppgifter nedan eller klicka på en ikon för att logga in:

WordPress.com Logo

Du kommenterar med ditt WordPress.com-konto. Logga ut / Ändra )

Twitter-bild

Du kommenterar med ditt Twitter-konto. Logga ut / Ändra )

Facebook-foto

Du kommenterar med ditt Facebook-konto. Logga ut / Ändra )

Google+ photo

Du kommenterar med ditt Google+-konto. Logga ut / Ändra )

Ansluter till %s