Referensen de glömde: Ett mänskligt genom till

Det är på modet att bestämma DNA-sekvensen för enskilda människors kromosomer.

En artikel i Nature Genetics rapporterade nyss om ännu en sådan genomsekvens, från en japansk man. I TT-notisen om artikeln (och då kanske också i Nature Genetics’ presskit?) står det att det är den sjunde individuella genomsekvensen. De verkar ha missat sekvenseringen av en irländares genom i tidigare i år. Får det inte en ganska komisk klang — det första japanska genomet, det första irländska genomet…?

Varför sekvensera individuella genom? Den mänskliga genomsekvensen, som vi känner och älskar, är en referenssekvens byggd på prover från anonyma (och några kända) donatorer. Referensgenomet ger oss en bra uppfattning om genomets övergripande form, vilka gener som finns och hur de liknar och skiljer sig från andra arter. Men det finns forfarande en värld av genetisk variation mellan människor att upptäcka.

HapMap är ett projekt som syftar till kartlägga den variationen genom att, i stora drag, hitta ett stort antal SNP:ar (ställen där ett baspar skiljer sig) — och en del CNV:er (sekvenser som uppträder i ingen eller flera kopior) — och typa dem i grupper av försökspersoner från olika delar av världen.

Men varför nöja sig med genetiska markörer när det går att få sekvenser? Med nya tekniker för DNA-sekvensering börjar det bli realistiskt att med referenssekvensen som stöd sekvensera om hela genomet från enskilda individer. Metoderna är lite olika, men de ger alla mycket korta DNA-sekvenser, några tiotal baser. (Gammal hederlig Sangersekvensering ger minst några hundra.) Istället producerar de väldigt väldigt många — inte för inte kallas de ibland ”massivt parallella”. Per bas räknat blir genomsekvenserna mycket snabbare och billigare, men det är fortfarande svindyrt — särskilt som vi måste räkna in den datorkraft som går åt.

Som Mike the Mad Biologist, en biologibloggare jag gillar, uttrycker det: ”The exciting thing about the recent technological advances in genomics is that we have a massive amount of data. The terrifying thing about the recent technological advances in genomics is that we have a massive amount of data.”

Litteratur

Fujimoto A et al. (2010) Whole-genome sequencing and comprehensive variant analysis of a Japanese individual using massively parallel sequencing. Nature Genetics. Förhandspublicerat 24 oktober.

Tong P et al. (2010) Sequencing and analysis of an Irish human genome. Genome Biology 11 R91

2 thoughts on “Referensen de glömde: Ett mänskligt genom till

  1. Pingback: Referensen de glömde: 1000 mänskliga genom « There is grandeur in this view of life

  2. Pingback: agcgaaaaagtggaaaacagcgaacgcattaacggc (Så går det till, del 4) « There is grandeur in this view of life

Kommentera

Fyll i dina uppgifter nedan eller klicka på en ikon för att logga in:

WordPress.com Logo

Du kommenterar med ditt WordPress.com-konto. Logga ut / Ändra )

Twitter-bild

Du kommenterar med ditt Twitter-konto. Logga ut / Ändra )

Facebook-foto

Du kommenterar med ditt Facebook-konto. Logga ut / Ändra )

Google+ photo

Du kommenterar med ditt Google+-konto. Logga ut / Ändra )

Ansluter till %s